naei (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
95
Structured Review
New England Biolabs
naei
Naei, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 134 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/naei/NaeI/pm42813690-325-17-20
Average 95 stars, based on 134 article reviews
Naei, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 134 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/naei/NaeI/pm42813690-325-17-20
Average 95 stars, based on 134 article reviews
naei - by Bioz Stars,
2026-11
95/100 stars
Images
Related Articles
Genomic Sequencing:Article Title: Identification of evolutionary conserved and diverged regulatory elements of embryonic Msx1 expression among amniote species via 3D-genome analyses and in vivo assays. Article Snippet: The Msx1 gene encodes a homeobox transcription factor that regulates numerous patterning events during the development of organs such as the limb bud and jaw primordium.. In craniofacial development, Msx1 is involved not only in the proximal–distal patterning of the jaw but also in the spatial arrangement of different tooth types along the proximal-distal axis in various mammalian species.. Our previous study demonstrated that speciesspecific differences in Msx1 expression within the jaw primordium contribute to the establishment of distinct dental formulas. De-Phosphorylation Assay:Article Title: Mechanisms of HIV Latency in Hematopoietic Progenitors: GFI1 as a Key Regulator Article Snippet: The sequence of the synthesized hU6-MCS gBlocks DNA fragment (IDT) (XbaI-hU6-MCS-PmeI, 296 bp) is: AAATCTAGAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGC TGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATA CGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAA ATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCT TGTGGAAAGGACGAAACACCGGTCCGCAGGTATGCACGCGTGTTAACGTTTAAACAA A Oligonucleotide sequences used for shRNA constructs: shRNA-74, ATTCCCTCCGTTTAGAGAATG; shRNA-978, ACTGTCCACACACCTGCTTAT; shRNA-1052, AGAAGTCAGACATGAAGAAAC; shRNA-1060, GACATGAAGAAACACACTTTC; shRNA-1247, AGACGCAGCATGGGCTCAAAT; shRNA-1834, AGGTGGACAAATGCTAATATT. .. pNL4-3 ΔGPE-GFP (McNamara et al., 2012 ) was digested with XhoI (NEB cat# R0146) and Gel Purification:Article Title: Mechanisms of HIV Latency in Hematopoietic Progenitors: GFI1 as a Key Regulator Article Snippet: The sequence of the synthesized hU6-MCS gBlocks DNA fragment (IDT) (XbaI-hU6-MCS-PmeI, 296 bp) is: AAATCTAGAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGC TGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATA CGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAA ATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCT TGTGGAAAGGACGAAACACCGGTCCGCAGGTATGCACGCGTGTTAACGTTTAAACAA A Oligonucleotide sequences used for shRNA constructs: shRNA-74, ATTCCCTCCGTTTAGAGAATG; shRNA-978, ACTGTCCACACACCTGCTTAT; shRNA-1052, AGAAGTCAGACATGAAGAAAC; shRNA-1060, GACATGAAGAAACACACTTTC; shRNA-1247, AGACGCAGCATGGGCTCAAAT; shRNA-1834, AGGTGGACAAATGCTAATATT. .. pNL4-3 ΔGPE-GFP (McNamara et al., 2012 ) was digested with XhoI (NEB cat# R0146) and Sequencing:Article Title: Methods of lowering the error rate of massively parallel DNA sequencing using duplex consensus sequencing Article Snippet: M13mp2 DNA was isolated from E. coli strain MC1061 by Qiagen Miniprep. .. To allow for greater sequencing depth at a defined region of the M13mp2 genome, an 840-bp fragment was enriched by complete digestion with the restriction enzymes Bsu36I and Isolation:Article Title: Methods of lowering the error rate of massively parallel DNA sequencing using duplex consensus sequencing Article Snippet: M13mp2 DNA was isolated from E. coli strain MC1061 by Qiagen Miniprep. .. To allow for greater sequencing depth at a defined region of the M13mp2 genome, an 840-bp fragment was enriched by complete digestion with the restriction enzymes Bsu36I and Article Title: Ribosomal Incorporation of Thioxanthone as a Noncanonical Amino Acid Facilitates the Engineering of Photoenzymes Article Snippet: .. To remove the sfGFP_S2TAG reporter plasmid, the isolated plasmids were digested with Agarose Gel Electrophoresis:Article Title: Methods of lowering the error rate of massively parallel DNA sequencing using duplex consensus sequencing Article Snippet: M13mp2 DNA was isolated from E. coli strain MC1061 by Qiagen Miniprep. .. To allow for greater sequencing depth at a defined region of the M13mp2 genome, an 840-bp fragment was enriched by complete digestion with the restriction enzymes Bsu36I and Plasmid Preparation:Article Title: Ribosomal Incorporation of Thioxanthone as a Noncanonical Amino Acid Facilitates the Engineering of Photoenzymes Article Snippet: .. To remove the sfGFP_S2TAG reporter plasmid, the isolated plasmids were digested with Purification:Article Title: Ribosomal Incorporation of Thioxanthone as a Noncanonical Amino Acid Facilitates the Engineering of Photoenzymes Article Snippet: .. To remove the sfGFP_S2TAG reporter plasmid, the isolated plasmids were digested with Generated:Article Title: The H19/miR-760/BST2 regulatory axis sustains breast cancer tumorigenesis and metastasis. Article Snippet: For the construction of the miRNA reporter, a fragment of BST2 (415 bp) and a fragment of H19 (451 bp), both containing the seed sequence ofmiR-760, were each cloned in a pMIRREPORT Firefly luciferase vector (Ambion, #AM5795). .. Both fragments were generated by PCR (primers are listed in supplemental data, Table S1) and cloned between Polymerase Chain Reaction:Article Title: The H19/miR-760/BST2 regulatory axis sustains breast cancer tumorigenesis and metastasis. Article Snippet: For the construction of the miRNA reporter, a fragment of BST2 (415 bp) and a fragment of H19 (451 bp), both containing the seed sequence ofmiR-760, were each cloned in a pMIRREPORT Firefly luciferase vector (Ambion, #AM5795). .. Both fragments were generated by PCR (primers are listed in supplemental data, Table S1) and cloned between Clone Assay:Article Title: The H19/miR-760/BST2 regulatory axis sustains breast cancer tumorigenesis and metastasis. Article Snippet: For the construction of the miRNA reporter, a fragment of BST2 (415 bp) and a fragment of H19 (451 bp), both containing the seed sequence ofmiR-760, were each cloned in a pMIRREPORT Firefly luciferase vector (Ambion, #AM5795). .. Both fragments were generated by PCR (primers are listed in supplemental data, Table S1) and cloned between other:Article Title: Integrating natural and engineered genetic variations to decode regulatory influence on blood traits Article Snippet: |